|
ATCC
t5 caption a7 minimum inhibitory concentration against ab atcc 19606 mic T5 Caption A7 Minimum Inhibitory Concentration Against Ab Atcc 19606 Mic, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/t5 caption a7 minimum inhibitory concentration against ab atcc 19606 mic/product/ATCC Average 99 stars, based on 1 article reviews
t5 caption a7 minimum inhibitory concentration against ab atcc 19606 mic - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Miltenyi Biotec
t5 caption a7 source mitochondrial isolation kit k d T5 Caption A7 Source Mitochondrial Isolation Kit K D, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/t5 caption a7 source mitochondrial isolation kit k d/product/Miltenyi Biotec Average 95 stars, based on 1 article reviews
t5 caption a7 source mitochondrial isolation kit k d - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
Bio-Rad
t5 caption a7 antibody size T5 Caption A7 Antibody Size, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/t5 caption a7 antibody size/product/Bio-Rad Average 85 stars, based on 1 article reviews
t5 caption a7 antibody size - by Bioz Stars,
2026-03
85/100 stars
|
Buy from Supplier |
|
Proteintech
t5 caption a7 gene forward reverse atg3 5 atgagcaacggcagccttta ![]() T5 Caption A7 Gene Forward Reverse Atg3 5 Atgagcaacggcagccttta, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/t5 caption a7 gene forward reverse atg3 5 atgagcaacggcagccttta/product/Proteintech Average 93 stars, based on 1 article reviews
t5 caption a7 gene forward reverse atg3 5 atgagcaacggcagccttta - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
R&D Systems
t5 caption a7 names ![]() T5 Caption A7 Names, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/t5 caption a7 names/product/R&D Systems Average 90 stars, based on 1 article reviews
t5 caption a7 names - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Cedarlane
pgp9.5 ![]() Pgp9.5, supplied by Cedarlane, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgp9.5/product/Cedarlane Average 90 stars, based on 1 article reviews
pgp9.5 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Siemens AG
siemens low igg1 ![]() Siemens Low Igg1, supplied by Siemens AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/siemens low igg1/product/Siemens AG Average 90 stars, based on 1 article reviews
siemens low igg1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Alomone Labs
caption a7 anti slo1 antibodies ![]() Caption A7 Anti Slo1 Antibodies, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 anti slo1 antibodies/product/Alomone Labs Average 94 stars, based on 1 article reviews
caption a7 anti slo1 antibodies - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Sanquin
infliximab ria–leuven elisa ![]() Infliximab Ria–Leuven Elisa, supplied by Sanquin, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/infliximab ria–leuven elisa/product/Sanquin Average 90 stars, based on 1 article reviews
infliximab ria–leuven elisa - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
fitc cd45 antibody ![]() Fitc Cd45 Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/fitc cd45 antibody/product/Thermo Fisher Average 90 stars, based on 1 article reviews
fitc cd45 antibody - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Eli Lilly
abciximab ![]() Abciximab, supplied by Eli Lilly, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/abciximab/product/Eli Lilly Average 90 stars, based on 1 article reviews
abciximab - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
primary antibodies ntcp (mouse) ![]() Primary Antibodies Ntcp (Mouse), supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primary antibodies ntcp (mouse)/product/Santa Cruz Biotechnology Average 90 stars, based on 1 article reviews
primary antibodies ntcp (mouse) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Acta Cardiologica Sinica
Article Title: The Effect of Shen-Yuan-Dan Capsule on Autophagy-Related Gene Atg13 Promoter Methylation and Genomic Methylation Levels in Atherosclerotic Mice
doi: 10.6515/ACS.202005_36(3).20190906B
Figure Lengend Snippet: The primers in RT-PCR of this study
Article Snippet: Glyceraldehyde 3-phosphate dehydrogenase (GAPDH;
Techniques:
Journal: Acta Cardiologica Sinica
Article Title: The Effect of Shen-Yuan-Dan Capsule on Autophagy-Related Gene Atg13 Promoter Methylation and Genomic Methylation Levels in Atherosclerotic Mice
doi: 10.6515/ACS.202005_36(3).20190906B
Figure Lengend Snippet: The autophagic genes based on the DNA methylation array
Article Snippet: Glyceraldehyde 3-phosphate dehydrogenase (GAPDH;
Techniques: DNA Methylation Assay
Journal: Journal of Clinical Laboratory Analysis
Article Title: Similar but not consistent: Revisiting the pitfalls of measuring IgG subclasses with different assays
doi: 10.1002/jcla.22146
Figure Lengend Snippet: Relative difference plots (Bland‐Altman) for the comparison of the Siemens IgGSc with The Binding Site (TBS) IgGSc assay for all four IgG subclasses: IgG1, IgG2, IgG3, and IgG4. The grey lines denote the zero deviation, whereas the solid black lines denote the mean deviation and the dashed black lines the 95% limit of agreement (LoA)
Article Snippet: 18 table ft1 table-wrap mode="anchored" t5 Table 2
Techniques: Comparison, Binding Assay
Journal: Journal of Clinical Laboratory Analysis
Article Title: Similar but not consistent: Revisiting the pitfalls of measuring IgG subclasses with different assays
doi: 10.1002/jcla.22146
Figure Lengend Snippet: Box‐and‐whisker plots for the comparison of the measurement of the IgG subclasses (IgG1, IgG2, IgG3, and IgG4) with the Siemens IgGSc (white boxes) and The Binding Site (TBS) IgGSc (grey boxes) assay. The central boxes represent the values from the lower to upper quartiles (25‐75 percentiles). The horizontal line in the boxes represents the median value from the measurement of 50 patient samples and the error bars indicate the minimum and maximum values. The Siemens IgGSc and the TBS IgGSc assay differed significantly from each other for each of the four subclasses (Wilcoxon paired sample test, P<.001)
Article Snippet: 18 table ft1 table-wrap mode="anchored" t5 Table 2
Techniques: Whisker Assay, Comparison, Binding Assay
Journal: Journal of Clinical Laboratory Analysis
Article Title: Similar but not consistent: Revisiting the pitfalls of measuring IgG subclasses with different assays
doi: 10.1002/jcla.22146
Figure Lengend Snippet: Cohen's kappa coefficient (κ) for the degree of agreement between the Siemens and The Binding Site (TBS) IgGSc assay. Kappa is given for each individual IgG subclass as well as over all four subclasses with the standard error (SE) and 95% confidence interval (95% CI)
Article Snippet: 18 table ft1 table-wrap mode="anchored" t5 Table 2
Techniques: Binding Assay
Journal: Journal of Clinical Laboratory Analysis
Article Title: Similar but not consistent: Revisiting the pitfalls of measuring IgG subclasses with different assays
doi: 10.1002/jcla.22146
Figure Lengend Snippet: Individual and total subclass classification agreement (in %) between the Siemens and The Binding Site (TBS) IgGSc assay based on the assay‐specific reference intervals. Classification is based on being either below (low), within (normal), or above (high) the reference range
Article Snippet: 18 table ft1 table-wrap mode="anchored" t5 Table 2
Techniques: Binding Assay
Journal: Journal of Clinical Laboratory Analysis
Article Title: Similar but not consistent: Revisiting the pitfalls of measuring IgG subclasses with different assays
doi: 10.1002/jcla.22146
Figure Lengend Snippet: Precision and bias for the Siemens and The Binding Site (TBS) IgGSc assay based on the EP15‐A3 CLSI guideline. Imprecision is given as within‐run coefficient of variation (within run CV) and the total coefficient of variation (total CV) for each of the four subclasses at two different concentration levels (target value). Bias is given as absolute bias (bias) from the respective target value
Article Snippet: 18 table ft1 table-wrap mode="anchored" t5 Table 2
Techniques: Binding Assay, Concentration Assay
Journal:
Article Title: Immunolocalization of the Ca 2+ -Activated K + Channel Slo1 in Axons and Nerve Terminals of Mammalian Brain and Cultured Neurons
doi: 10.1002/cne.20931
Figure Lengend Snippet: Summary of Slo1 Antibodies
Article Snippet: We also characterize the localization of exogenously expressed Slo1 α subunits in hippocampal neurons developing in culture that exhibit a prominent localization of Slo1 in axons and presynaptic terminals. table ft1 table-wrap mode="anchored" t5 Table 1
Techniques:
Journal:
Article Title: Immunolocalization of the Ca 2+ -Activated K + Channel Slo1 in Axons and Nerve Terminals of Mammalian Brain and Cultured Neurons
doi: 10.1002/cne.20931
Figure Lengend Snippet: A, immunoblot analysis of brain membrane fractions from adult rats, and wild-type and Slo1-deficient mice. Proteins were fractionated on 7.5% SDS-PAGE and transferred to nitrocellulose membranes and probed with mouse monoclonal (L6/60, 10 µg/ml) or rabbit polyclonal anti-Slo1 (Alomone, 1:500; Chemicon, 1:200), or mouse monoclonal anti-Kv2.1 (K89/41, TC supe 1:2) antibodies as noted. Numbers to left denote mobility of prestained molecular weight standards in kD.
Article Snippet: We also characterize the localization of exogenously expressed Slo1 α subunits in hippocampal neurons developing in culture that exhibit a prominent localization of Slo1 in axons and presynaptic terminals. table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Western Blot, Membrane, SDS Page, Molecular Weight
Journal:
Article Title: Immunolocalization of the Ca 2+ -Activated K + Channel Slo1 in Axons and Nerve Terminals of Mammalian Brain and Cultured Neurons
doi: 10.1002/cne.20931
Figure Lengend Snippet: A: Immunoblot analysis of the effects of alkaline phosphatase (AP) digestion on adult rat brain Slo1. Adult rat brain membranes treated without (−) or with 0.1 U/ml AP (+) for 3 h at 37°C were separated on 7.5% SDS-PAGE and transferred to nitrocellulose membranes, then probed with anti-Kv2.1 (K89/41 mouse mAb, TC supe 1:2), anti-Kv1.4 (K13/31 mouse mAb, TC supe 1:2), anti-GluR1 (rabbit polyclonal antibody, Upstate 1:1000), or anti-Slo1 (L6/60, 10 µg/ml) antibodies. Slo1 exhibited AP- shifts from Mr ≈ 135 to ≈ 128 kD (bands 1 and 2 indicated on the right). Brain Kv2.1 also shifted in Mr upon AP treatment, whereas Kv1.4 and GluR1 did not. B: Immunoblot analysis of developmental rat brain membrane samples. L6/60 (10 µg/ml) immunostaining at postnatal day 2 (P2) revealed at least three distinct bands as indicated in the left margin (1, 135 kD; 2, 131 kD; 3, 124 kD), which changed in their relative proportions during postnatal development. A=adult, C=adult sample incubated 3 h at 37°C without AP, AP=adult sample incubated 3 h at 37°C with AP. Numbers to left denote mobility of prestained molecular weight standards in kD.
Article Snippet: We also characterize the localization of exogenously expressed Slo1 α subunits in hippocampal neurons developing in culture that exhibit a prominent localization of Slo1 in axons and presynaptic terminals. table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Western Blot, SDS Page, Membrane, Immunostaining, Incubation, Molecular Weight
Journal:
Article Title: Immunolocalization of the Ca 2+ -Activated K + Channel Slo1 in Axons and Nerve Terminals of Mammalian Brain and Cultured Neurons
doi: 10.1002/cne.20931
Figure Lengend Snippet: A–C: L6/60 staining in adult rat hippocampus A: overview of L6/60 (0.6 µg/ml) immunoperoxidase staining in hippocampus. B, C: higher magnification images of the staining shown in A. B: stratum lucidum of the CA3 region of the hippocampus. C: magnified view of mossy fiber axons. Arrows in A–C highlight anatomical landmarks that specify the regions magnified. D–E: double label immunofluorescence labeling of brain sections from wild-type (D, WT) and Slo1-deficient (E, KO) mice. Brain sections from these mice were stained with L6/60 (24 µg/ml) mAb in red, and anti-Kv2.1 (KC rabbit polyclonal, 1:100) antibody in green. Images were taken from the hilus of the dentate gyrus and CA3 stratum lucidum. Scale bars, A:, 500 µm; B, C: 100 µm; D: 50 µm.
Article Snippet: We also characterize the localization of exogenously expressed Slo1 α subunits in hippocampal neurons developing in culture that exhibit a prominent localization of Slo1 in axons and presynaptic terminals. table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Staining, Immunoperoxidase Staining, Immunofluorescence, Labeling
Journal:
Article Title: Immunolocalization of the Ca 2+ -Activated K + Channel Slo1 in Axons and Nerve Terminals of Mammalian Brain and Cultured Neurons
doi: 10.1002/cne.20931
Figure Lengend Snippet: Magnified view of stratum lucidum of CA3 region of hippocampus. A–C: somata and apical dendrites of CA3 pyramidal neurons were negatively stained with L6/60 (A, 24 µg/ml) as well as with anti-Kv1.4 antibody (B, K13/31 mouse mAb, TC supe 1:2), which overlapped in mossy fibers (C). D–F: in contrast, somatodendritic Kv2.1 (D, KC rabbit polyclonal antibody, 1:100) staining interdigitated with L6/60 staining (E), indicating the presence of Slo1 on synaptic terminals on the Kv2.1-positive apical dendrites of CA3 pyramidal neurons (F, overlay). Scale bars, 10 µm.
Article Snippet: We also characterize the localization of exogenously expressed Slo1 α subunits in hippocampal neurons developing in culture that exhibit a prominent localization of Slo1 in axons and presynaptic terminals. table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Staining
Journal:
Article Title: Immunolocalization of the Ca 2+ -Activated K + Channel Slo1 in Axons and Nerve Terminals of Mammalian Brain and Cultured Neurons
doi: 10.1002/cne.20931
Figure Lengend Snippet: These photomicrographs show the pattern of immunoreactivity for the indicated subunits in the unoperated, control hemisphere (A–E) and operated hemisphere (F–J) of an animal that sustained a circumscribed unilateral ibotenic acid lesion. This lesion destroyed cells in the distal CA1 subfield, prosubiculum and subiculum, and also destroyed a central portion of the dentate gyrus. The entire CA3 and proximal CA1 subfield was spared by this lesion. This lesion greatly reduced the density of Slo1 (A, F; L6/60 TC supe 1:10), and Kv1.4 (B, G; K13/31 TC supe 1:10) in stratum lucidum of CA3, but did not affect binding of secondary antibody alone (C, H), nor staining for Slo1 (D, I; L6/60 TC supe 1:10), and Kv1.4 (E, J; K13/31 TC supe 1:10) in the terminal fields of striatal effernts to globus pallidus.
Article Snippet: We also characterize the localization of exogenously expressed Slo1 α subunits in hippocampal neurons developing in culture that exhibit a prominent localization of Slo1 in axons and presynaptic terminals. table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Control, Binding Assay, Staining
Journal:
Article Title: Immunolocalization of the Ca 2+ -Activated K + Channel Slo1 in Axons and Nerve Terminals of Mammalian Brain and Cultured Neurons
doi: 10.1002/cne.20931
Figure Lengend Snippet: A: low magnification view of L6/60 (0.6 µg/ml) immunoperoxidase staining near the primary fissure. Note moderate to high levels of staining in the molecular layer relative to the granule cell layer, and intense staining at/near the Purkinje cell layer. B: higher magnification view of the area boxed in A, showing intense L6/60 staining in the Purkinje cell layer. The arrowheads point to a Purkinje cell soma, while the arrow points to a basket cell pinceau terminal onto a Purkinje cell initial segment. C–D: Double label immunofluorescence staining of brain sections from wild-type (C: WT) and Slo1-deficient (D: KO) mice. Brain sections from these mice were stained with L6/60 mAb (24 µg/ml) in red, and anti-Kv2.1 (KC rabbit polyclonal, 1:100) antibody in green. Images were taken from the Purkinje cell layer and reveal that staining in Purkinje cell somata, basket cell terminals, and the molecular layer is eliminated in the Slo1 knockout. Scale bars, A:, 100 µm; B, C: 500 µm; D: 10 µm.
Article Snippet: We also characterize the localization of exogenously expressed Slo1 α subunits in hippocampal neurons developing in culture that exhibit a prominent localization of Slo1 in axons and presynaptic terminals. table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Immunoperoxidase Staining, Staining, Immunofluorescence, Knock-Out
Journal:
Article Title: Immunolocalization of the Ca 2+ -Activated K + Channel Slo1 in Axons and Nerve Terminals of Mammalian Brain and Cultured Neurons
doi: 10.1002/cne.20931
Figure Lengend Snippet: Confocal images of double label immunofluorescence staining. A–C: Slo1 and Kv1.2 localization in basket cell terminals. L6/60 (A: 24 µg/ml) staining overlaps with that for Kv1.2 (B: K14/16 mouse mAb, 16 µg/ml) in basket cell terminals (C: overlay); D–F: L6/60 (D: 24 µg/ml) staining encircles axon initial segments of Purkinje cells, stained with anti-NF-155/186 antibody (E: L11A/41 mouse mAb, TC supe 1:2; F: overlay). G–H: dendrites of multiple Purkinje cells, filled with anti-calbindin (H: Sigma mouse monoclonal, 16 µg/ml) staining, were associated with membrane-associated L6/60 staining (G: 24 µg/ml; I: overlay). J–L: localization of Slo1 in Purkinje cell somata. Slo1 staining (J: L6/60; 24 µg/ml) on the somata of Purkinje cells partially overlapped with Kv2.1 (K: KC rabbit polyclonal antibody, 1:100) surface clusters (L: overlay). Scale bars, 10 µm.
Article Snippet: We also characterize the localization of exogenously expressed Slo1 α subunits in hippocampal neurons developing in culture that exhibit a prominent localization of Slo1 in axons and presynaptic terminals. table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Immunofluorescence, Staining, Membrane
Journal:
Article Title: Immunolocalization of the Ca 2+ -Activated K + Channel Slo1 in Axons and Nerve Terminals of Mammalian Brain and Cultured Neurons
doi: 10.1002/cne.20931
Figure Lengend Snippet: A–C: Localization of endogenous Slo1. Neurons at 24 DIV were fixed, permeabilized with 0.1% Triton X-100 and stained with anti-Slo1 antibody L6/60 (A: 24 µg/ml; green) to detect the total pool of endogenous rSlo1, and anti-MAP2 (B: Sigma mouse mAb, 1:1000; C: overlay). D–F: Localization of surface hSlo1. Neurons at 11 DIV were fixed, stained with anti-Myc antibody (E: mouse monoclonal 1-9E10, 1 µg/ml) for cell surface hSlo1 (green), and then permeabilized with 0.1% Triton X-100 for L6/60 (D: 5 µg/ml) staining (red) to detect the total pool of exogenous hSlo1 and endogenous rSlo1 (F: overlay). Arrow points to a presumably untransfected neuron in the culture. Panel D inset: hSlo in both axons and dendrites was detected on a longer exposure. G: Surface Myc-positive (mouse mAb 19E10, 1 µg/ml) processes overlap with axonal tau (Sigma mouse monoclonal antibody 1:2000) staining. H–J: Surface Myc-positive (H: mouse mAb 19E10, 1 µg/ml) processes do not overlap with dendritic MAP-2 (I: Sigma mouse mAb, 1:1000) staining (J: overlay). Scale bars, A–F:, 20 µm; D inset: 50 µm ; G: 10 µm; H–J: 10 µm.
Article Snippet: We also characterize the localization of exogenously expressed Slo1 α subunits in hippocampal neurons developing in culture that exhibit a prominent localization of Slo1 in axons and presynaptic terminals. table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Staining
Journal: Frontline Gastroenterology
Article Title: Assays for measurement of TNF antagonists in practice
doi: 10.1136/flgastro-2016-100692
Figure Lengend Snippet: Antidrug antibody assay comparative studies
Article Snippet: 36 table ft1 table-wrap mode="anchored" t5 Table 2
Techniques: Comparison, Enzyme-linked Immunosorbent Assay
Journal: AJNR: American Journal of Neuroradiology
Article Title: Initial Experience with the Use of Intravenous Eptifibatide Bolus during Endovascular Treatment of Intracranial Aneurysms
doi:
Figure Lengend Snippet: Complications following endovascular coiling with eptifibatide
Article Snippet: 26 table ft1 table-wrap mode="anchored" t5 Table 5:
Techniques: Dissection
Journal: AJNR: American Journal of Neuroradiology
Article Title: Initial Experience with the Use of Intravenous Eptifibatide Bolus during Endovascular Treatment of Intracranial Aneurysms
doi:
Figure Lengend Snippet: Review of emergency treatments of periprocedural thromboembolism
Article Snippet: 26 table ft1 table-wrap mode="anchored" t5 Table 5:
Techniques:
Journal: AJNR: American Journal of Neuroradiology
Article Title: Initial Experience with the Use of Intravenous Eptifibatide Bolus during Endovascular Treatment of Intracranial Aneurysms
doi:
Figure Lengend Snippet: Comparison of the glycoprotein IIb/IIIa antagonists
Article Snippet: 26 table ft1 table-wrap mode="anchored" t5 Table 5:
Techniques: