t5 caption a7 antibody size Search Results


99
ATCC t5 caption a7 minimum inhibitory concentration against ab atcc 19606 mic
T5 Caption A7 Minimum Inhibitory Concentration Against Ab Atcc 19606 Mic, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t5 caption a7 minimum inhibitory concentration against ab atcc 19606 mic/product/ATCC
Average 99 stars, based on 1 article reviews
t5 caption a7 minimum inhibitory concentration against ab atcc 19606 mic - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

95
Miltenyi Biotec t5 caption a7 source mitochondrial isolation kit k d
T5 Caption A7 Source Mitochondrial Isolation Kit K D, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t5 caption a7 source mitochondrial isolation kit k d/product/Miltenyi Biotec
Average 95 stars, based on 1 article reviews
t5 caption a7 source mitochondrial isolation kit k d - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

85
Bio-Rad t5 caption a7 antibody size
T5 Caption A7 Antibody Size, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t5 caption a7 antibody size/product/Bio-Rad
Average 85 stars, based on 1 article reviews
t5 caption a7 antibody size - by Bioz Stars, 2026-03
85/100 stars
  Buy from Supplier

93
Proteintech t5 caption a7 gene forward reverse atg3 5 atgagcaacggcagccttta
The primers in RT-PCR of this study
T5 Caption A7 Gene Forward Reverse Atg3 5 Atgagcaacggcagccttta, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t5 caption a7 gene forward reverse atg3 5 atgagcaacggcagccttta/product/Proteintech
Average 93 stars, based on 1 article reviews
t5 caption a7 gene forward reverse atg3 5 atgagcaacggcagccttta - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
R&D Systems t5 caption a7 names
The primers in RT-PCR of this study
T5 Caption A7 Names, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t5 caption a7 names/product/R&D Systems
Average 90 stars, based on 1 article reviews
t5 caption a7 names - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Cedarlane pgp9.5
The primers in RT-PCR of this study
Pgp9.5, supplied by Cedarlane, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgp9.5/product/Cedarlane
Average 90 stars, based on 1 article reviews
pgp9.5 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Siemens AG siemens low igg1
Relative difference plots (Bland‐Altman) for the comparison of the Siemens IgGSc with The Binding Site <t>(TBS)</t> IgGSc assay for all four IgG subclasses: <t>IgG1,</t> IgG2, IgG3, and IgG4. The grey lines denote the zero deviation, whereas the solid black lines denote the mean deviation and the dashed black lines the 95% limit of agreement (LoA)
Siemens Low Igg1, supplied by Siemens AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/siemens low igg1/product/Siemens AG
Average 90 stars, based on 1 article reviews
siemens low igg1 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

94
Alomone Labs caption a7 anti slo1 antibodies
Summary of <t> Slo1 </t> Antibodies
Caption A7 Anti Slo1 Antibodies, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caption a7 anti slo1 antibodies/product/Alomone Labs
Average 94 stars, based on 1 article reviews
caption a7 anti slo1 antibodies - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

90
Sanquin infliximab ria–leuven elisa
Antidrug antibody assay comparative studies
Infliximab Ria–Leuven Elisa, supplied by Sanquin, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/infliximab ria–leuven elisa/product/Sanquin
Average 90 stars, based on 1 article reviews
infliximab ria–leuven elisa - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Thermo Fisher fitc cd45 antibody
Antidrug antibody assay comparative studies
Fitc Cd45 Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fitc cd45 antibody/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
fitc cd45 antibody - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Eli Lilly abciximab
Complications following endovascular coiling with <t> eptifibatide </t>
Abciximab, supplied by Eli Lilly, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/abciximab/product/Eli Lilly
Average 90 stars, based on 1 article reviews
abciximab - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology primary antibodies ntcp (mouse)
Complications following endovascular coiling with <t> eptifibatide </t>
Primary Antibodies Ntcp (Mouse), supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primary antibodies ntcp (mouse)/product/Santa Cruz Biotechnology
Average 90 stars, based on 1 article reviews
primary antibodies ntcp (mouse) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


The primers in RT-PCR of this study

Journal: Acta Cardiologica Sinica

Article Title: The Effect of Shen-Yuan-Dan Capsule on Autophagy-Related Gene Atg13 Promoter Methylation and Genomic Methylation Levels in Atherosclerotic Mice

doi: 10.6515/ACS.202005_36(3).20190906B

Figure Lengend Snippet: The primers in RT-PCR of this study

Article Snippet: Glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Proteintech Group) was used as the reference gene. table ft1 table-wrap mode="anchored" t5 caption a7 Gene Forward Reverse Atg3 5′-ATGAGCAACGGCAGCCTTTA-3′ 5′-ATCACTTCAGCATGCCTGCA-3′ Atg13 5′-ATTTCAGAACCCCCCTCAGC-3′ 5′-TCATGCACAGCCAGCTTCTC-3′ Atg4a 5′-AAACCCCTGCTGCTCATTGT-3′ 5′-GCCCCTAAAGACTGTGGCAT-3′ GAPDH 5′-GGCAAATTCAACGGCACAGT-3′ 5′-ACGACATACTCAGCACCGGC-3′ Open in a separate window GAPDH, glyceraldehyde 3-phosphate dehydrogenase; RT-PCR, reverse transcription polymerase chain reaction. caption a8 The primers in RT-PCR of this study

Techniques:

The autophagic genes based on the DNA methylation array

Journal: Acta Cardiologica Sinica

Article Title: The Effect of Shen-Yuan-Dan Capsule on Autophagy-Related Gene Atg13 Promoter Methylation and Genomic Methylation Levels in Atherosclerotic Mice

doi: 10.6515/ACS.202005_36(3).20190906B

Figure Lengend Snippet: The autophagic genes based on the DNA methylation array

Article Snippet: Glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Proteintech Group) was used as the reference gene. table ft1 table-wrap mode="anchored" t5 caption a7 Gene Forward Reverse Atg3 5′-ATGAGCAACGGCAGCCTTTA-3′ 5′-ATCACTTCAGCATGCCTGCA-3′ Atg13 5′-ATTTCAGAACCCCCCTCAGC-3′ 5′-TCATGCACAGCCAGCTTCTC-3′ Atg4a 5′-AAACCCCTGCTGCTCATTGT-3′ 5′-GCCCCTAAAGACTGTGGCAT-3′ GAPDH 5′-GGCAAATTCAACGGCACAGT-3′ 5′-ACGACATACTCAGCACCGGC-3′ Open in a separate window GAPDH, glyceraldehyde 3-phosphate dehydrogenase; RT-PCR, reverse transcription polymerase chain reaction. caption a8 The primers in RT-PCR of this study

Techniques: DNA Methylation Assay

Relative difference plots (Bland‐Altman) for the comparison of the Siemens IgGSc with The Binding Site (TBS) IgGSc assay for all four IgG subclasses: IgG1, IgG2, IgG3, and IgG4. The grey lines denote the zero deviation, whereas the solid black lines denote the mean deviation and the dashed black lines the 95% limit of agreement (LoA)

Journal: Journal of Clinical Laboratory Analysis

Article Title: Similar but not consistent: Revisiting the pitfalls of measuring IgG subclasses with different assays

doi: 10.1002/jcla.22146

Figure Lengend Snippet: Relative difference plots (Bland‐Altman) for the comparison of the Siemens IgGSc with The Binding Site (TBS) IgGSc assay for all four IgG subclasses: IgG1, IgG2, IgG3, and IgG4. The grey lines denote the zero deviation, whereas the solid black lines denote the mean deviation and the dashed black lines the 95% limit of agreement (LoA)

Article Snippet: 18 table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 TBS Low Normal High Siemens Low IgG1 8% IgG1 IgG1 IgG2 17% IgG2 IgG2 IgG3 6% IgG3 IgG3 IgG4 6% IgG4 2% IgG4 Normal IgG1 8% IgG1 63% IgG1 IgG2 12% IgG2 65% IgG2 IgG3 2% IgG3 81% IgG3 4% IgG4 4% IgG4 74% IgG4 2% High IgG1 IgG1 4% IgG1 17% IgG2 IgG2 IgG2 6% IgG3 IgG3 4% IgG3 4% IgG4 IgG4 2% IgG4 10% Open in a separate window Total agreement: IgG1, 88%; IgG2, 88%; IgG3, 91%; IgG4, 90%; All IgGSc, 68%.

Techniques: Comparison, Binding Assay

Box‐and‐whisker plots for the comparison of the measurement of the IgG subclasses (IgG1, IgG2, IgG3, and IgG4) with the Siemens IgGSc (white boxes) and The Binding Site (TBS) IgGSc (grey boxes) assay. The central boxes represent the values from the lower to upper quartiles (25‐75 percentiles). The horizontal line in the boxes represents the median value from the measurement of 50 patient samples and the error bars indicate the minimum and maximum values. The Siemens IgGSc and the TBS IgGSc assay differed significantly from each other for each of the four subclasses (Wilcoxon paired sample test, P<.001)

Journal: Journal of Clinical Laboratory Analysis

Article Title: Similar but not consistent: Revisiting the pitfalls of measuring IgG subclasses with different assays

doi: 10.1002/jcla.22146

Figure Lengend Snippet: Box‐and‐whisker plots for the comparison of the measurement of the IgG subclasses (IgG1, IgG2, IgG3, and IgG4) with the Siemens IgGSc (white boxes) and The Binding Site (TBS) IgGSc (grey boxes) assay. The central boxes represent the values from the lower to upper quartiles (25‐75 percentiles). The horizontal line in the boxes represents the median value from the measurement of 50 patient samples and the error bars indicate the minimum and maximum values. The Siemens IgGSc and the TBS IgGSc assay differed significantly from each other for each of the four subclasses (Wilcoxon paired sample test, P<.001)

Article Snippet: 18 table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 TBS Low Normal High Siemens Low IgG1 8% IgG1 IgG1 IgG2 17% IgG2 IgG2 IgG3 6% IgG3 IgG3 IgG4 6% IgG4 2% IgG4 Normal IgG1 8% IgG1 63% IgG1 IgG2 12% IgG2 65% IgG2 IgG3 2% IgG3 81% IgG3 4% IgG4 4% IgG4 74% IgG4 2% High IgG1 IgG1 4% IgG1 17% IgG2 IgG2 IgG2 6% IgG3 IgG3 4% IgG3 4% IgG4 IgG4 2% IgG4 10% Open in a separate window Total agreement: IgG1, 88%; IgG2, 88%; IgG3, 91%; IgG4, 90%; All IgGSc, 68%.

Techniques: Whisker Assay, Comparison, Binding Assay

Cohen's kappa coefficient (κ) for the degree of agreement between the Siemens and The Binding Site  (TBS)  IgGSc assay. Kappa is given for each individual IgG subclass as well as over all four subclasses with the standard error (SE) and 95% confidence interval (95% CI)

Journal: Journal of Clinical Laboratory Analysis

Article Title: Similar but not consistent: Revisiting the pitfalls of measuring IgG subclasses with different assays

doi: 10.1002/jcla.22146

Figure Lengend Snippet: Cohen's kappa coefficient (κ) for the degree of agreement between the Siemens and The Binding Site (TBS) IgGSc assay. Kappa is given for each individual IgG subclass as well as over all four subclasses with the standard error (SE) and 95% confidence interval (95% CI)

Article Snippet: 18 table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 TBS Low Normal High Siemens Low IgG1 8% IgG1 IgG1 IgG2 17% IgG2 IgG2 IgG3 6% IgG3 IgG3 IgG4 6% IgG4 2% IgG4 Normal IgG1 8% IgG1 63% IgG1 IgG2 12% IgG2 65% IgG2 IgG3 2% IgG3 81% IgG3 4% IgG4 4% IgG4 74% IgG4 2% High IgG1 IgG1 4% IgG1 17% IgG2 IgG2 IgG2 6% IgG3 IgG3 4% IgG3 4% IgG4 IgG4 2% IgG4 10% Open in a separate window Total agreement: IgG1, 88%; IgG2, 88%; IgG3, 91%; IgG4, 90%; All IgGSc, 68%.

Techniques: Binding Assay

Individual and total subclass classification agreement (in %) between the Siemens and The Binding Site  (TBS)  IgGSc assay based on the assay‐specific reference intervals. Classification is based on being either below (low), within (normal), or above (high) the reference range

Journal: Journal of Clinical Laboratory Analysis

Article Title: Similar but not consistent: Revisiting the pitfalls of measuring IgG subclasses with different assays

doi: 10.1002/jcla.22146

Figure Lengend Snippet: Individual and total subclass classification agreement (in %) between the Siemens and The Binding Site (TBS) IgGSc assay based on the assay‐specific reference intervals. Classification is based on being either below (low), within (normal), or above (high) the reference range

Article Snippet: 18 table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 TBS Low Normal High Siemens Low IgG1 8% IgG1 IgG1 IgG2 17% IgG2 IgG2 IgG3 6% IgG3 IgG3 IgG4 6% IgG4 2% IgG4 Normal IgG1 8% IgG1 63% IgG1 IgG2 12% IgG2 65% IgG2 IgG3 2% IgG3 81% IgG3 4% IgG4 4% IgG4 74% IgG4 2% High IgG1 IgG1 4% IgG1 17% IgG2 IgG2 IgG2 6% IgG3 IgG3 4% IgG3 4% IgG4 IgG4 2% IgG4 10% Open in a separate window Total agreement: IgG1, 88%; IgG2, 88%; IgG3, 91%; IgG4, 90%; All IgGSc, 68%.

Techniques: Binding Assay

Precision and bias for the Siemens and The Binding Site  (TBS)  IgGSc assay based on the EP15‐A3 CLSI guideline. Imprecision is given as within‐run coefficient of variation (within run CV) and the total coefficient of variation (total CV) for each of the four subclasses at two different concentration levels (target value). Bias is given as absolute bias (bias) from the respective target value

Journal: Journal of Clinical Laboratory Analysis

Article Title: Similar but not consistent: Revisiting the pitfalls of measuring IgG subclasses with different assays

doi: 10.1002/jcla.22146

Figure Lengend Snippet: Precision and bias for the Siemens and The Binding Site (TBS) IgGSc assay based on the EP15‐A3 CLSI guideline. Imprecision is given as within‐run coefficient of variation (within run CV) and the total coefficient of variation (total CV) for each of the four subclasses at two different concentration levels (target value). Bias is given as absolute bias (bias) from the respective target value

Article Snippet: 18 table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 TBS Low Normal High Siemens Low IgG1 8% IgG1 IgG1 IgG2 17% IgG2 IgG2 IgG3 6% IgG3 IgG3 IgG4 6% IgG4 2% IgG4 Normal IgG1 8% IgG1 63% IgG1 IgG2 12% IgG2 65% IgG2 IgG3 2% IgG3 81% IgG3 4% IgG4 4% IgG4 74% IgG4 2% High IgG1 IgG1 4% IgG1 17% IgG2 IgG2 IgG2 6% IgG3 IgG3 4% IgG3 4% IgG4 IgG4 2% IgG4 10% Open in a separate window Total agreement: IgG1, 88%; IgG2, 88%; IgG3, 91%; IgG4, 90%; All IgGSc, 68%.

Techniques: Binding Assay, Concentration Assay

Summary of  Slo1  Antibodies

Journal:

Article Title: Immunolocalization of the Ca 2+ -Activated K + Channel Slo1 in Axons and Nerve Terminals of Mammalian Brain and Cultured Neurons

doi: 10.1002/cne.20931

Figure Lengend Snippet: Summary of Slo1 Antibodies

Article Snippet: We also characterize the localization of exogenously expressed Slo1 α subunits in hippocampal neurons developing in culture that exhibit a prominent localization of Slo1 in axons and presynaptic terminals. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Anti-slo1 antibodies used in this study L6/60 mouse monoclonal IgG2a GST Fusion protein 690–1196 Mapped to within 690–891 Alomone APC-021, lot AN-04 Rabbit polyclonal GST Fusion protein 1098–1196 Chemicon AB5228, lot 22040170 Rabbit polyclonal GST Fusion protein 1098–1196 Anti-slo1 antibodies used in other studies Martin et al., 2004 .

Techniques:

A, immunoblot analysis of brain membrane fractions from adult rats, and wild-type and Slo1-deficient mice. Proteins were fractionated on 7.5% SDS-PAGE and transferred to nitrocellulose membranes and probed with mouse monoclonal (L6/60, 10 µg/ml) or rabbit polyclonal anti-Slo1 (Alomone, 1:500; Chemicon, 1:200), or mouse monoclonal anti-Kv2.1 (K89/41, TC supe 1:2) antibodies as noted. Numbers to left denote mobility of prestained molecular weight standards in kD.

Journal:

Article Title: Immunolocalization of the Ca 2+ -Activated K + Channel Slo1 in Axons and Nerve Terminals of Mammalian Brain and Cultured Neurons

doi: 10.1002/cne.20931

Figure Lengend Snippet: A, immunoblot analysis of brain membrane fractions from adult rats, and wild-type and Slo1-deficient mice. Proteins were fractionated on 7.5% SDS-PAGE and transferred to nitrocellulose membranes and probed with mouse monoclonal (L6/60, 10 µg/ml) or rabbit polyclonal anti-Slo1 (Alomone, 1:500; Chemicon, 1:200), or mouse monoclonal anti-Kv2.1 (K89/41, TC supe 1:2) antibodies as noted. Numbers to left denote mobility of prestained molecular weight standards in kD.

Article Snippet: We also characterize the localization of exogenously expressed Slo1 α subunits in hippocampal neurons developing in culture that exhibit a prominent localization of Slo1 in axons and presynaptic terminals. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Anti-slo1 antibodies used in this study L6/60 mouse monoclonal IgG2a GST Fusion protein 690–1196 Mapped to within 690–891 Alomone APC-021, lot AN-04 Rabbit polyclonal GST Fusion protein 1098–1196 Chemicon AB5228, lot 22040170 Rabbit polyclonal GST Fusion protein 1098–1196 Anti-slo1 antibodies used in other studies Martin et al., 2004 .

Techniques: Western Blot, Membrane, SDS Page, Molecular Weight

A: Immunoblot analysis of the effects of alkaline phosphatase (AP) digestion on adult rat brain Slo1. Adult rat brain membranes treated without (−) or with 0.1 U/ml AP (+) for 3 h at 37°C were separated on 7.5% SDS-PAGE and transferred to nitrocellulose membranes, then probed with anti-Kv2.1 (K89/41 mouse mAb, TC supe 1:2), anti-Kv1.4 (K13/31 mouse mAb, TC supe 1:2), anti-GluR1 (rabbit polyclonal antibody, Upstate 1:1000), or anti-Slo1 (L6/60, 10 µg/ml) antibodies. Slo1 exhibited AP- shifts from Mr ≈ 135 to ≈ 128 kD (bands 1 and 2 indicated on the right). Brain Kv2.1 also shifted in Mr upon AP treatment, whereas Kv1.4 and GluR1 did not. B: Immunoblot analysis of developmental rat brain membrane samples. L6/60 (10 µg/ml) immunostaining at postnatal day 2 (P2) revealed at least three distinct bands as indicated in the left margin (1, 135 kD; 2, 131 kD; 3, 124 kD), which changed in their relative proportions during postnatal development. A=adult, C=adult sample incubated 3 h at 37°C without AP, AP=adult sample incubated 3 h at 37°C with AP. Numbers to left denote mobility of prestained molecular weight standards in kD.

Journal:

Article Title: Immunolocalization of the Ca 2+ -Activated K + Channel Slo1 in Axons and Nerve Terminals of Mammalian Brain and Cultured Neurons

doi: 10.1002/cne.20931

Figure Lengend Snippet: A: Immunoblot analysis of the effects of alkaline phosphatase (AP) digestion on adult rat brain Slo1. Adult rat brain membranes treated without (−) or with 0.1 U/ml AP (+) for 3 h at 37°C were separated on 7.5% SDS-PAGE and transferred to nitrocellulose membranes, then probed with anti-Kv2.1 (K89/41 mouse mAb, TC supe 1:2), anti-Kv1.4 (K13/31 mouse mAb, TC supe 1:2), anti-GluR1 (rabbit polyclonal antibody, Upstate 1:1000), or anti-Slo1 (L6/60, 10 µg/ml) antibodies. Slo1 exhibited AP- shifts from Mr ≈ 135 to ≈ 128 kD (bands 1 and 2 indicated on the right). Brain Kv2.1 also shifted in Mr upon AP treatment, whereas Kv1.4 and GluR1 did not. B: Immunoblot analysis of developmental rat brain membrane samples. L6/60 (10 µg/ml) immunostaining at postnatal day 2 (P2) revealed at least three distinct bands as indicated in the left margin (1, 135 kD; 2, 131 kD; 3, 124 kD), which changed in their relative proportions during postnatal development. A=adult, C=adult sample incubated 3 h at 37°C without AP, AP=adult sample incubated 3 h at 37°C with AP. Numbers to left denote mobility of prestained molecular weight standards in kD.

Article Snippet: We also characterize the localization of exogenously expressed Slo1 α subunits in hippocampal neurons developing in culture that exhibit a prominent localization of Slo1 in axons and presynaptic terminals. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Anti-slo1 antibodies used in this study L6/60 mouse monoclonal IgG2a GST Fusion protein 690–1196 Mapped to within 690–891 Alomone APC-021, lot AN-04 Rabbit polyclonal GST Fusion protein 1098–1196 Chemicon AB5228, lot 22040170 Rabbit polyclonal GST Fusion protein 1098–1196 Anti-slo1 antibodies used in other studies Martin et al., 2004 .

Techniques: Western Blot, SDS Page, Membrane, Immunostaining, Incubation, Molecular Weight

A–C: L6/60 staining in adult rat hippocampus A: overview of L6/60 (0.6 µg/ml) immunoperoxidase staining in hippocampus. B, C: higher magnification images of the staining shown in A. B: stratum lucidum of the CA3 region of the hippocampus. C: magnified view of mossy fiber axons. Arrows in A–C highlight anatomical landmarks that specify the regions magnified. D–E: double label immunofluorescence labeling of brain sections from wild-type (D, WT) and Slo1-deficient (E, KO) mice. Brain sections from these mice were stained with L6/60 (24 µg/ml) mAb in red, and anti-Kv2.1 (KC rabbit polyclonal, 1:100) antibody in green. Images were taken from the hilus of the dentate gyrus and CA3 stratum lucidum. Scale bars, A:, 500 µm; B, C: 100 µm; D: 50 µm.

Journal:

Article Title: Immunolocalization of the Ca 2+ -Activated K + Channel Slo1 in Axons and Nerve Terminals of Mammalian Brain and Cultured Neurons

doi: 10.1002/cne.20931

Figure Lengend Snippet: A–C: L6/60 staining in adult rat hippocampus A: overview of L6/60 (0.6 µg/ml) immunoperoxidase staining in hippocampus. B, C: higher magnification images of the staining shown in A. B: stratum lucidum of the CA3 region of the hippocampus. C: magnified view of mossy fiber axons. Arrows in A–C highlight anatomical landmarks that specify the regions magnified. D–E: double label immunofluorescence labeling of brain sections from wild-type (D, WT) and Slo1-deficient (E, KO) mice. Brain sections from these mice were stained with L6/60 (24 µg/ml) mAb in red, and anti-Kv2.1 (KC rabbit polyclonal, 1:100) antibody in green. Images were taken from the hilus of the dentate gyrus and CA3 stratum lucidum. Scale bars, A:, 500 µm; B, C: 100 µm; D: 50 µm.

Article Snippet: We also characterize the localization of exogenously expressed Slo1 α subunits in hippocampal neurons developing in culture that exhibit a prominent localization of Slo1 in axons and presynaptic terminals. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Anti-slo1 antibodies used in this study L6/60 mouse monoclonal IgG2a GST Fusion protein 690–1196 Mapped to within 690–891 Alomone APC-021, lot AN-04 Rabbit polyclonal GST Fusion protein 1098–1196 Chemicon AB5228, lot 22040170 Rabbit polyclonal GST Fusion protein 1098–1196 Anti-slo1 antibodies used in other studies Martin et al., 2004 .

Techniques: Staining, Immunoperoxidase Staining, Immunofluorescence, Labeling

Magnified view of stratum lucidum of CA3 region of hippocampus. A–C: somata and apical dendrites of CA3 pyramidal neurons were negatively stained with L6/60 (A, 24 µg/ml) as well as with anti-Kv1.4 antibody (B, K13/31 mouse mAb, TC supe 1:2), which overlapped in mossy fibers (C). D–F: in contrast, somatodendritic Kv2.1 (D, KC rabbit polyclonal antibody, 1:100) staining interdigitated with L6/60 staining (E), indicating the presence of Slo1 on synaptic terminals on the Kv2.1-positive apical dendrites of CA3 pyramidal neurons (F, overlay). Scale bars, 10 µm.

Journal:

Article Title: Immunolocalization of the Ca 2+ -Activated K + Channel Slo1 in Axons and Nerve Terminals of Mammalian Brain and Cultured Neurons

doi: 10.1002/cne.20931

Figure Lengend Snippet: Magnified view of stratum lucidum of CA3 region of hippocampus. A–C: somata and apical dendrites of CA3 pyramidal neurons were negatively stained with L6/60 (A, 24 µg/ml) as well as with anti-Kv1.4 antibody (B, K13/31 mouse mAb, TC supe 1:2), which overlapped in mossy fibers (C). D–F: in contrast, somatodendritic Kv2.1 (D, KC rabbit polyclonal antibody, 1:100) staining interdigitated with L6/60 staining (E), indicating the presence of Slo1 on synaptic terminals on the Kv2.1-positive apical dendrites of CA3 pyramidal neurons (F, overlay). Scale bars, 10 µm.

Article Snippet: We also characterize the localization of exogenously expressed Slo1 α subunits in hippocampal neurons developing in culture that exhibit a prominent localization of Slo1 in axons and presynaptic terminals. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Anti-slo1 antibodies used in this study L6/60 mouse monoclonal IgG2a GST Fusion protein 690–1196 Mapped to within 690–891 Alomone APC-021, lot AN-04 Rabbit polyclonal GST Fusion protein 1098–1196 Chemicon AB5228, lot 22040170 Rabbit polyclonal GST Fusion protein 1098–1196 Anti-slo1 antibodies used in other studies Martin et al., 2004 .

Techniques: Staining

These photomicrographs show the pattern of immunoreactivity for the indicated subunits in the unoperated, control hemisphere (A–E) and operated hemisphere (F–J) of an animal that sustained a circumscribed unilateral ibotenic acid lesion. This lesion destroyed cells in the distal CA1 subfield, prosubiculum and subiculum, and also destroyed a central portion of the dentate gyrus. The entire CA3 and proximal CA1 subfield was spared by this lesion. This lesion greatly reduced the density of Slo1 (A, F; L6/60 TC supe 1:10), and Kv1.4 (B, G; K13/31 TC supe 1:10) in stratum lucidum of CA3, but did not affect binding of secondary antibody alone (C, H), nor staining for Slo1 (D, I; L6/60 TC supe 1:10), and Kv1.4 (E, J; K13/31 TC supe 1:10) in the terminal fields of striatal effernts to globus pallidus.

Journal:

Article Title: Immunolocalization of the Ca 2+ -Activated K + Channel Slo1 in Axons and Nerve Terminals of Mammalian Brain and Cultured Neurons

doi: 10.1002/cne.20931

Figure Lengend Snippet: These photomicrographs show the pattern of immunoreactivity for the indicated subunits in the unoperated, control hemisphere (A–E) and operated hemisphere (F–J) of an animal that sustained a circumscribed unilateral ibotenic acid lesion. This lesion destroyed cells in the distal CA1 subfield, prosubiculum and subiculum, and also destroyed a central portion of the dentate gyrus. The entire CA3 and proximal CA1 subfield was spared by this lesion. This lesion greatly reduced the density of Slo1 (A, F; L6/60 TC supe 1:10), and Kv1.4 (B, G; K13/31 TC supe 1:10) in stratum lucidum of CA3, but did not affect binding of secondary antibody alone (C, H), nor staining for Slo1 (D, I; L6/60 TC supe 1:10), and Kv1.4 (E, J; K13/31 TC supe 1:10) in the terminal fields of striatal effernts to globus pallidus.

Article Snippet: We also characterize the localization of exogenously expressed Slo1 α subunits in hippocampal neurons developing in culture that exhibit a prominent localization of Slo1 in axons and presynaptic terminals. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Anti-slo1 antibodies used in this study L6/60 mouse monoclonal IgG2a GST Fusion protein 690–1196 Mapped to within 690–891 Alomone APC-021, lot AN-04 Rabbit polyclonal GST Fusion protein 1098–1196 Chemicon AB5228, lot 22040170 Rabbit polyclonal GST Fusion protein 1098–1196 Anti-slo1 antibodies used in other studies Martin et al., 2004 .

Techniques: Control, Binding Assay, Staining

A: low magnification view of L6/60 (0.6 µg/ml) immunoperoxidase staining near the primary fissure. Note moderate to high levels of staining in the molecular layer relative to the granule cell layer, and intense staining at/near the Purkinje cell layer. B: higher magnification view of the area boxed in A, showing intense L6/60 staining in the Purkinje cell layer. The arrowheads point to a Purkinje cell soma, while the arrow points to a basket cell pinceau terminal onto a Purkinje cell initial segment. C–D: Double label immunofluorescence staining of brain sections from wild-type (C: WT) and Slo1-deficient (D: KO) mice. Brain sections from these mice were stained with L6/60 mAb (24 µg/ml) in red, and anti-Kv2.1 (KC rabbit polyclonal, 1:100) antibody in green. Images were taken from the Purkinje cell layer and reveal that staining in Purkinje cell somata, basket cell terminals, and the molecular layer is eliminated in the Slo1 knockout. Scale bars, A:, 100 µm; B, C: 500 µm; D: 10 µm.

Journal:

Article Title: Immunolocalization of the Ca 2+ -Activated K + Channel Slo1 in Axons and Nerve Terminals of Mammalian Brain and Cultured Neurons

doi: 10.1002/cne.20931

Figure Lengend Snippet: A: low magnification view of L6/60 (0.6 µg/ml) immunoperoxidase staining near the primary fissure. Note moderate to high levels of staining in the molecular layer relative to the granule cell layer, and intense staining at/near the Purkinje cell layer. B: higher magnification view of the area boxed in A, showing intense L6/60 staining in the Purkinje cell layer. The arrowheads point to a Purkinje cell soma, while the arrow points to a basket cell pinceau terminal onto a Purkinje cell initial segment. C–D: Double label immunofluorescence staining of brain sections from wild-type (C: WT) and Slo1-deficient (D: KO) mice. Brain sections from these mice were stained with L6/60 mAb (24 µg/ml) in red, and anti-Kv2.1 (KC rabbit polyclonal, 1:100) antibody in green. Images were taken from the Purkinje cell layer and reveal that staining in Purkinje cell somata, basket cell terminals, and the molecular layer is eliminated in the Slo1 knockout. Scale bars, A:, 100 µm; B, C: 500 µm; D: 10 µm.

Article Snippet: We also characterize the localization of exogenously expressed Slo1 α subunits in hippocampal neurons developing in culture that exhibit a prominent localization of Slo1 in axons and presynaptic terminals. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Anti-slo1 antibodies used in this study L6/60 mouse monoclonal IgG2a GST Fusion protein 690–1196 Mapped to within 690–891 Alomone APC-021, lot AN-04 Rabbit polyclonal GST Fusion protein 1098–1196 Chemicon AB5228, lot 22040170 Rabbit polyclonal GST Fusion protein 1098–1196 Anti-slo1 antibodies used in other studies Martin et al., 2004 .

Techniques: Immunoperoxidase Staining, Staining, Immunofluorescence, Knock-Out

Confocal images of double label immunofluorescence staining. A–C: Slo1 and Kv1.2 localization in basket cell terminals. L6/60 (A: 24 µg/ml) staining overlaps with that for Kv1.2 (B: K14/16 mouse mAb, 16 µg/ml) in basket cell terminals (C: overlay); D–F: L6/60 (D: 24 µg/ml) staining encircles axon initial segments of Purkinje cells, stained with anti-NF-155/186 antibody (E: L11A/41 mouse mAb, TC supe 1:2; F: overlay). G–H: dendrites of multiple Purkinje cells, filled with anti-calbindin (H: Sigma mouse monoclonal, 16 µg/ml) staining, were associated with membrane-associated L6/60 staining (G: 24 µg/ml; I: overlay). J–L: localization of Slo1 in Purkinje cell somata. Slo1 staining (J: L6/60; 24 µg/ml) on the somata of Purkinje cells partially overlapped with Kv2.1 (K: KC rabbit polyclonal antibody, 1:100) surface clusters (L: overlay). Scale bars, 10 µm.

Journal:

Article Title: Immunolocalization of the Ca 2+ -Activated K + Channel Slo1 in Axons and Nerve Terminals of Mammalian Brain and Cultured Neurons

doi: 10.1002/cne.20931

Figure Lengend Snippet: Confocal images of double label immunofluorescence staining. A–C: Slo1 and Kv1.2 localization in basket cell terminals. L6/60 (A: 24 µg/ml) staining overlaps with that for Kv1.2 (B: K14/16 mouse mAb, 16 µg/ml) in basket cell terminals (C: overlay); D–F: L6/60 (D: 24 µg/ml) staining encircles axon initial segments of Purkinje cells, stained with anti-NF-155/186 antibody (E: L11A/41 mouse mAb, TC supe 1:2; F: overlay). G–H: dendrites of multiple Purkinje cells, filled with anti-calbindin (H: Sigma mouse monoclonal, 16 µg/ml) staining, were associated with membrane-associated L6/60 staining (G: 24 µg/ml; I: overlay). J–L: localization of Slo1 in Purkinje cell somata. Slo1 staining (J: L6/60; 24 µg/ml) on the somata of Purkinje cells partially overlapped with Kv2.1 (K: KC rabbit polyclonal antibody, 1:100) surface clusters (L: overlay). Scale bars, 10 µm.

Article Snippet: We also characterize the localization of exogenously expressed Slo1 α subunits in hippocampal neurons developing in culture that exhibit a prominent localization of Slo1 in axons and presynaptic terminals. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Anti-slo1 antibodies used in this study L6/60 mouse monoclonal IgG2a GST Fusion protein 690–1196 Mapped to within 690–891 Alomone APC-021, lot AN-04 Rabbit polyclonal GST Fusion protein 1098–1196 Chemicon AB5228, lot 22040170 Rabbit polyclonal GST Fusion protein 1098–1196 Anti-slo1 antibodies used in other studies Martin et al., 2004 .

Techniques: Immunofluorescence, Staining, Membrane

A–C: Localization of endogenous Slo1. Neurons at 24 DIV were fixed, permeabilized with 0.1% Triton X-100 and stained with anti-Slo1 antibody L6/60 (A: 24 µg/ml; green) to detect the total pool of endogenous rSlo1, and anti-MAP2 (B: Sigma mouse mAb, 1:1000; C: overlay). D–F: Localization of surface hSlo1. Neurons at 11 DIV were fixed, stained with anti-Myc antibody (E: mouse monoclonal 1-9E10, 1 µg/ml) for cell surface hSlo1 (green), and then permeabilized with 0.1% Triton X-100 for L6/60 (D: 5 µg/ml) staining (red) to detect the total pool of exogenous hSlo1 and endogenous rSlo1 (F: overlay). Arrow points to a presumably untransfected neuron in the culture. Panel D inset: hSlo in both axons and dendrites was detected on a longer exposure. G: Surface Myc-positive (mouse mAb 19E10, 1 µg/ml) processes overlap with axonal tau (Sigma mouse monoclonal antibody 1:2000) staining. H–J: Surface Myc-positive (H: mouse mAb 19E10, 1 µg/ml) processes do not overlap with dendritic MAP-2 (I: Sigma mouse mAb, 1:1000) staining (J: overlay). Scale bars, A–F:, 20 µm; D inset: 50 µm ; G: 10 µm; H–J: 10 µm.

Journal:

Article Title: Immunolocalization of the Ca 2+ -Activated K + Channel Slo1 in Axons and Nerve Terminals of Mammalian Brain and Cultured Neurons

doi: 10.1002/cne.20931

Figure Lengend Snippet: A–C: Localization of endogenous Slo1. Neurons at 24 DIV were fixed, permeabilized with 0.1% Triton X-100 and stained with anti-Slo1 antibody L6/60 (A: 24 µg/ml; green) to detect the total pool of endogenous rSlo1, and anti-MAP2 (B: Sigma mouse mAb, 1:1000; C: overlay). D–F: Localization of surface hSlo1. Neurons at 11 DIV were fixed, stained with anti-Myc antibody (E: mouse monoclonal 1-9E10, 1 µg/ml) for cell surface hSlo1 (green), and then permeabilized with 0.1% Triton X-100 for L6/60 (D: 5 µg/ml) staining (red) to detect the total pool of exogenous hSlo1 and endogenous rSlo1 (F: overlay). Arrow points to a presumably untransfected neuron in the culture. Panel D inset: hSlo in both axons and dendrites was detected on a longer exposure. G: Surface Myc-positive (mouse mAb 19E10, 1 µg/ml) processes overlap with axonal tau (Sigma mouse monoclonal antibody 1:2000) staining. H–J: Surface Myc-positive (H: mouse mAb 19E10, 1 µg/ml) processes do not overlap with dendritic MAP-2 (I: Sigma mouse mAb, 1:1000) staining (J: overlay). Scale bars, A–F:, 20 µm; D inset: 50 µm ; G: 10 µm; H–J: 10 µm.

Article Snippet: We also characterize the localization of exogenously expressed Slo1 α subunits in hippocampal neurons developing in culture that exhibit a prominent localization of Slo1 in axons and presynaptic terminals. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Anti-slo1 antibodies used in this study L6/60 mouse monoclonal IgG2a GST Fusion protein 690–1196 Mapped to within 690–891 Alomone APC-021, lot AN-04 Rabbit polyclonal GST Fusion protein 1098–1196 Chemicon AB5228, lot 22040170 Rabbit polyclonal GST Fusion protein 1098–1196 Anti-slo1 antibodies used in other studies Martin et al., 2004 .

Techniques: Staining

Antidrug antibody assay comparative studies

Journal: Frontline Gastroenterology

Article Title: Assays for measurement of TNF antagonists in practice

doi: 10.1136/flgastro-2016-100692

Figure Lengend Snippet: Antidrug antibody assay comparative studies

Article Snippet: 36 table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 Drug Comparison Pearson r correlation Spearman r correlation Reference Infliximab Sanquin RIA–Leuven ELISA 0.95 – 35 Sanquin RIA–Theradiag ELISA 0.99 – Leuven ELISA–Theradiag ELISA 0.97 – Infliximab Biomonitor RIA–Prometheus ELISA 0.82 0.64 36 Biomonitor RIA–Prometheus HMSA 0.77 0.81 Biomonitor RIA–RGA 0.80 0.67 RGA–Prometheus ELISA 0.96 0.78 RGA–Prometheus HMSA 0.78 0.58 Prometheus ELISA–Prometheus HMSA 0.81 0.54 Infliximab ELISA–RIA 0.73 – 37 ELISA–RGA 0.93 ELISA–EIA 0.89 RIA–RGA 0.75 – RIA–EIA 0.71 – RGA–EIA 0.93 – Infliximab Promonitor ELISA–Sanquin RIA 0.973 – 38 Adalimumab Promonitor ELISA–Sanquin RIA 0.996 – 38 Open in a separate window EIA, enzyme immunoassay; HMSA, homogenous mobility shift assay; RGA, reporter gene assay; RIA, radioimmunoassay.

Techniques: Comparison, Enzyme-linked Immunosorbent Assay

Complications following endovascular coiling with  eptifibatide

Journal: AJNR: American Journal of Neuroradiology

Article Title: Initial Experience with the Use of Intravenous Eptifibatide Bolus during Endovascular Treatment of Intracranial Aneurysms

doi:

Figure Lengend Snippet: Complications following endovascular coiling with eptifibatide

Article Snippet: 26 table ft1 table-wrap mode="anchored" t5 Table 5: caption a7 Abciximab Tirofiban Eptifibatide Manufacturer Eli Lilly Merck COR Therapeutics Molecule size, datons 50,000 800 500 Receptor affinity ( K D ) High (5 nmol/L) Low (15 nmol/L) Low (120 nmol/L) Plasma high-life, h 0.2 1.5–2 2–4 Biologic half-life, h 12–24 1.5–2 2–4 Excretion Renal Renal/hepatic Renal Method of reversal Platelet transfusion Fresh-frozen plasma, cryprecipitate, platelet transfusion Fresh-frozen plasma, cryprecipitate, platelet transfusion Open in a separate window Comparison of the glycoprotein IIb/IIIa antagonists Eptifibatide has theoretical advantages over abciximab in patients undergoing coil embolization procedures.

Techniques: Dissection

Review of emergency treatments of periprocedural thromboembolism

Journal: AJNR: American Journal of Neuroradiology

Article Title: Initial Experience with the Use of Intravenous Eptifibatide Bolus during Endovascular Treatment of Intracranial Aneurysms

doi:

Figure Lengend Snippet: Review of emergency treatments of periprocedural thromboembolism

Article Snippet: 26 table ft1 table-wrap mode="anchored" t5 Table 5: caption a7 Abciximab Tirofiban Eptifibatide Manufacturer Eli Lilly Merck COR Therapeutics Molecule size, datons 50,000 800 500 Receptor affinity ( K D ) High (5 nmol/L) Low (15 nmol/L) Low (120 nmol/L) Plasma high-life, h 0.2 1.5–2 2–4 Biologic half-life, h 12–24 1.5–2 2–4 Excretion Renal Renal/hepatic Renal Method of reversal Platelet transfusion Fresh-frozen plasma, cryprecipitate, platelet transfusion Fresh-frozen plasma, cryprecipitate, platelet transfusion Open in a separate window Comparison of the glycoprotein IIb/IIIa antagonists Eptifibatide has theoretical advantages over abciximab in patients undergoing coil embolization procedures.

Techniques:

Comparison of the glycoprotein IIb/IIIa antagonists

Journal: AJNR: American Journal of Neuroradiology

Article Title: Initial Experience with the Use of Intravenous Eptifibatide Bolus during Endovascular Treatment of Intracranial Aneurysms

doi:

Figure Lengend Snippet: Comparison of the glycoprotein IIb/IIIa antagonists

Article Snippet: 26 table ft1 table-wrap mode="anchored" t5 Table 5: caption a7 Abciximab Tirofiban Eptifibatide Manufacturer Eli Lilly Merck COR Therapeutics Molecule size, datons 50,000 800 500 Receptor affinity ( K D ) High (5 nmol/L) Low (15 nmol/L) Low (120 nmol/L) Plasma high-life, h 0.2 1.5–2 2–4 Biologic half-life, h 12–24 1.5–2 2–4 Excretion Renal Renal/hepatic Renal Method of reversal Platelet transfusion Fresh-frozen plasma, cryprecipitate, platelet transfusion Fresh-frozen plasma, cryprecipitate, platelet transfusion Open in a separate window Comparison of the glycoprotein IIb/IIIa antagonists Eptifibatide has theoretical advantages over abciximab in patients undergoing coil embolization procedures.

Techniques: